Example Result

Job_ID:
20220212205426

Job Description:
Homo_sapiens_U11_spliceosomal_RNA

Parameters:
  • ×

    Input Sequence

    AAAAGGCUUCUGUCGUGAGUGGCACACGUAGGGCAACUCGAUUGCCCUGCGUGCGGAAUCGACAUCAAGAGAUUUCGGAAGCAUAAUUUUUUGGUAUUUGGGCAGCUGGUGAUCGUUGGUCCCGGCGCCCUU

    (Download fasta)
  • Species: Homo sapiens
  • Selected Structure Prediction Tools:
    alifreefold, MaxExpect, ProbKnot, RME_DMS, SHAPEKnots, RNAfold, TurboFold, pknots, SPARSE, locaRNA, RNAalifold, RME_PARS, pKISS, RNAprob, Ipknot, MXSCARNA, RNALfold, comRNA
  • Significance level of functional interpretability: 0.05

The Meta-stable Structure (?):

Structure
 Best Functional Significance
(?)		 Cellular Fitness Interpretability
(?)		 RNA-Protein Interaction Interpretability
(?)		 Translational Regulation Interpretability
(?)		 Post-transcriptional Regulation Interpretability
(?)
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 2.110e-03*


* indicates statistical significance (q-value < 0.05)


The Rankings of the Structure Predictions:

Structure Best Functional Significance
(?)		 Cellular Fitness Interpretability
(?)		 RNA-Protein Interaction Interpretability
(?)		 Translational Regulation Interpretability
(?)		 Post-transcriptional Regulation Interpretability
(?)		 Generating Tool
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 3.249e-03* alifreefold
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 6.664e-04* MaxExpect
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 1.894e-05* ProbKnot
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 6.664e-04* RME_DMS
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 6.664e-04* SHAPEKnots
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 3.249e-03* RNAfold
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 6.664e-04* TurboFold
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 6.664e-04* pknots
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 3.249e-03* SPARSE
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 3.249e-03* locaRNA
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 3.249e-03* RNAalifold
[Visualization] [Fasta] 1.299e-26* 1.000 1.299e-26* 1.000 6.664e-04* RME_PARS
[Visualization] [Fasta] 3.357e-09* 1.000 6.261e-04* 1.000 3.357e-09* pKISS
[Visualization] [Fasta] 6.261e-04* 1.535e-01 6.261e-04* 1.000 2.110e-03* RNAprob
[Visualization] [Fasta] 6.261e-04* 1.000 6.261e-04* 1.000 2.666e-03* Ipknot
[Visualization] [Fasta] 2.086e-01 2.086e-01 1.000 1.000 1.000 MXSCARNA
[Visualization] [Fasta] 1.000 1.000 1.000 1.000 1.000 RNALfold
[Visualization] [Fasta] 1.000 1.000 1.000 1.000 1.000 comRNA


* indicates statistical significance (q-value < 0.05)


×

Meta-stable structure

Meta-stable structure refers to the most prevalent secondary structures of a given RNA sequence in the cellular contents.

More information

×

Best Functional Significance

The lowest interpretability q-value among the four functional aspects for each predicted structure. The results are in the form of q-values.

More information

×

Cellular Fitness Interpretability

This functional test evaluates the significance that the secondary structure performs vital cellular fitness determining functions.

More information

×

RNA-Protein Interaction Interpretability

This functional test evaluates the significance for the structure to carry out its functions cooperatively with proteins that contain corresponding RNA sequence/structure binding domains.

More information

×

Translational Regulation Interpretability

This functional test evaluates the significance for the structure to affect start codon accessibility that results in translation initiation regulation.

More information

×

Post-transcriptional Regulation Interpretability

This functional test evaluates the significance for the structure to participate in post-transcriptional regulation.

More information